Back to Multiple platform build/check report for BioC 3.19:   simplified   long
ABCDEFGHIJKLMNOPQ[R]STUVWXYZ

This page was generated on 2024-07-24 09:05 -0400 (Wed, 24 Jul 2024).

HostnameOSArch (*)R versionInstalled pkgs
nebbiolo1Linux (Ubuntu 22.04.3 LTS)x86_644.4.1 (2024-06-14) -- "Race for Your Life" 4747
palomino7Windows Server 2022 Datacenterx644.4.1 (2024-06-14 ucrt) -- "Race for Your Life" 4489
merida1macOS 12.7.5 Montereyx86_644.4.1 (2024-06-14) -- "Race for Your Life" 4518
kjohnson1macOS 13.6.6 Venturaarm644.4.1 (2024-06-14) -- "Race for Your Life" 4467
Click on any hostname to see more info about the system (e.g. compilers)      (*) as reported by 'uname -p', except on Windows and Mac OS X

Package 1747/2300HostnameOS / ArchINSTALLBUILDCHECKBUILD BIN
rfaRm 1.16.0  (landing page)
Lara Selles Vidal
Snapshot Date: 2024-07-21 14:00 -0400 (Sun, 21 Jul 2024)
git_url: https://git.bioconductor.org/packages/rfaRm
git_branch: RELEASE_3_19
git_last_commit: c0b9a92
git_last_commit_date: 2024-04-30 11:23:12 -0400 (Tue, 30 Apr 2024)
nebbiolo1Linux (Ubuntu 22.04.3 LTS) / x86_64  OK    OK    ERROR  
palomino7Windows Server 2022 Datacenter / x64  OK    OK    ERROR    OK  
merida1macOS 12.7.5 Monterey / x86_64  OK    ERROR  skippedskipped
kjohnson1macOS 13.6.6 Ventura / arm64  OK    ERROR  skippedskipped


CHECK results for rfaRm on palomino7

To the developers/maintainers of the rfaRm package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/rfaRm.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results


Summary

Package: rfaRm
Version: 1.16.0
Command: E:\biocbuild\bbs-3.19-bioc\R\bin\R.exe CMD check --no-multiarch --install=check:rfaRm.install-out.txt --library=E:\biocbuild\bbs-3.19-bioc\R\library --no-vignettes --timings rfaRm_1.16.0.tar.gz
StartedAt: 2024-07-22 05:31:17 -0400 (Mon, 22 Jul 2024)
EndedAt: 2024-07-22 05:33:43 -0400 (Mon, 22 Jul 2024)
EllapsedTime: 145.5 seconds
RetCode: 1
Status:   ERROR  
CheckDir: rfaRm.Rcheck
Warnings: NA

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   E:\biocbuild\bbs-3.19-bioc\R\bin\R.exe CMD check --no-multiarch --install=check:rfaRm.install-out.txt --library=E:\biocbuild\bbs-3.19-bioc\R\library --no-vignettes --timings rfaRm_1.16.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory 'E:/biocbuild/bbs-3.19-bioc/meat/rfaRm.Rcheck'
* using R version 4.4.1 (2024-06-14 ucrt)
* using platform: x86_64-w64-mingw32
* R was compiled by
    gcc.exe (GCC) 13.2.0
    GNU Fortran (GCC) 13.2.0
* running under: Windows Server 2022 x64 (build 20348)
* using session charset: UTF-8
* using option '--no-vignettes'
* checking for file 'rfaRm/DESCRIPTION' ... OK
* checking extension type ... Package
* this is package 'rfaRm' version '1.16.0'
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking whether package 'rfaRm' can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking 'build' directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking whether startup messages can be suppressed ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
rfamSeedAlignment: no visible global function definition for 'as'
Undefined global functions or variables:
  as
Consider adding
  importFrom("methods", "as")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking files in 'vignettes' ... OK
* checking examples ... ERROR
Running examples in 'rfaRm-Ex.R' failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: rfamSequenceSearch
> ### Title: Performs a sequence search of the Rfam database
> ### Aliases: rfamSequenceSearch
> 
> ### ** Examples
> 
> # Search the Rfam database for hits with a specific sequence, and store the
> # results in a nested list
> 
> searchHits <- rfamSequenceSearch("GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCAC
+ GAAAGUAUUUGCUUUGAUUUGGUGAAAUUCCAAAACCGACAGUAGAGUCUGGAUGAGAGAAGAUUC")
Running sequence search query. This might take a long time.
Error in base::strsplit(x, ...) : non-character argument
Calls: rfamSequenceSearch ... lapply -> FUN -> strsplit -> strsplit -> <Anonymous>
Execution halted
* checking for unstated dependencies in 'tests' ... OK
* checking tests ...
  Running 'runTests.R'
 ERROR
Running the tests in 'tests/runTests.R' failed.
Last 13 lines of output:
  
   
  1 Test Suite : 
  rfaRm RUnit Tests - 1 test function, 1 error, 0 failures
  ERROR in E:/biocbuild/bbs-3.19-bioc/tmpdir/RtmpKsRhza/RLIBS_ecc410045fae/rfaRm/unitTests/test_searchFunctions.R: Error while sourcing  E:/biocbuild/bbs-3.19-bioc/tmpdir/RtmpKsRhza/RLIBS_ecc410045fae/rfaRm/unitTests/test_searchFunctions.R : Error in base::strsplit(x, ...) : non-character argument
  
  Test files with failing tests
  
     test_searchFunctions.R 
       E:/biocbuild/bbs-3.19-bioc/tmpdir/RtmpKsRhza/RLIBS_ecc410045fae/rfaRm/unitTests/test_searchFunctions.R 
  
  
  Error in BiocGenerics:::testPackage("rfaRm") : 
    unit tests failed for package rfaRm
  Execution halted
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 2 ERRORs, 1 NOTE
See
  'E:/biocbuild/bbs-3.19-bioc/meat/rfaRm.Rcheck/00check.log'
for details.


Installation output

rfaRm.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   E:\biocbuild\bbs-3.19-bioc\R\bin\R.exe CMD INSTALL rfaRm
###
##############################################################################
##############################################################################


* installing to library 'E:/biocbuild/bbs-3.19-bioc/R/library'
* installing *source* package 'rfaRm' ...
** using staged installation
** R
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded from temporary location
** testing if installed package can be loaded from final location
** testing if installed package keeps a record of temporary installation path
* DONE (rfaRm)

Tests output

rfaRm.Rcheck/tests/runTests.Rout.fail


R version 4.4.1 (2024-06-14 ucrt) -- "Race for Your Life"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-w64-mingw32/x64

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> BiocGenerics:::testPackage("rfaRm")
Linking to librsvg 2.57.0
No encoding supplied: defaulting to UTF-8.
  format width height colorspace matte filesize density
1    SVG   700    550       sRGB  TRUE    17458   96x96
  format width height colorspace matte filesize density
1    GIF   600   2056       sRGB FALSE    62234   72x72
Running sequence search query. This might take a long time.
Error in base::strsplit(x, ...) : non-character argument


RUNIT TEST PROTOCOL -- Mon Jul 22 05:33:33 2024 
*********************************************** 
Number of test functions: 1 
Number of errors: 1 
Number of failures: 0 

 
1 Test Suite : 
rfaRm RUnit Tests - 1 test function, 1 error, 0 failures
ERROR in E:/biocbuild/bbs-3.19-bioc/tmpdir/RtmpKsRhza/RLIBS_ecc410045fae/rfaRm/unitTests/test_searchFunctions.R: Error while sourcing  E:/biocbuild/bbs-3.19-bioc/tmpdir/RtmpKsRhza/RLIBS_ecc410045fae/rfaRm/unitTests/test_searchFunctions.R : Error in base::strsplit(x, ...) : non-character argument

Test files with failing tests

   test_searchFunctions.R 
     E:/biocbuild/bbs-3.19-bioc/tmpdir/RtmpKsRhza/RLIBS_ecc410045fae/rfaRm/unitTests/test_searchFunctions.R 


Error in BiocGenerics:::testPackage("rfaRm") : 
  unit tests failed for package rfaRm
Execution halted

Example timings

rfaRm.Rcheck/rfaRm-Ex.timings

nameusersystemelapsed
rfamConsensusSecondaryStructure0.720.502.16
rfamCovarianceModel0.290.001.02
rfamFamilyAccessionToID0.030.000.10
rfamFamilyIDToAccession0.020.000.11
rfamFamilySummary0.060.000.61
rfamPDBMapping0.060.000.49
rfamSecondaryStructurePlot0.180.040.83
rfamSecondaryStructureXMLSVG0.040.000.59
rfamSeedAlignment0.660.002.53
rfamSeedTree0.080.000.45
rfamSeedTreeImage0.090.010.60
rfamSequenceRegions0.190.002.42