Back to Multiple platform build/check report for BioC 3.20: simplified long |
|
This page was generated on 2024-07-22 12:44 -0400 (Mon, 22 Jul 2024).
Hostname | OS | Arch (*) | R version | Installed pkgs |
---|---|---|---|---|
nebbiolo2 | Linux (Ubuntu 22.04.3 LTS) | x86_64 | 4.4.1 (2024-06-14) -- "Race for Your Life" | 4688 |
lconway | macOS 12.7.1 Monterey | x86_64 | 4.4.1 (2024-06-14) -- "Race for Your Life" | 4455 |
kjohnson3 | macOS 13.6.5 Ventura | arm64 | 4.4.1 (2024-06-14) -- "Race for Your Life" | 4404 |
Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X |
Package 1702/2248 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
rfaRm 1.17.0 (landing page) Lara Selles Vidal
| nebbiolo2 | Linux (Ubuntu 22.04.3 LTS) / x86_64 | OK | OK | ERROR | |||||||||
lconway | macOS 12.7.1 Monterey / x86_64 | OK | OK | ERROR | OK | |||||||||
kjohnson3 | macOS 13.6.5 Ventura / arm64 | OK | OK | ERROR | OK | |||||||||
To the developers/maintainers of the rfaRm package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/rfaRm.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
Package: rfaRm |
Version: 1.17.0 |
Command: /home/biocbuild/bbs-3.20-bioc/R/bin/R CMD check --install=check:rfaRm.install-out.txt --library=/home/biocbuild/bbs-3.20-bioc/R/site-library --timings rfaRm_1.17.0.tar.gz |
StartedAt: 2024-07-22 03:03:56 -0400 (Mon, 22 Jul 2024) |
EndedAt: 2024-07-22 03:06:30 -0400 (Mon, 22 Jul 2024) |
EllapsedTime: 154.3 seconds |
RetCode: 1 |
Status: ERROR |
CheckDir: rfaRm.Rcheck |
Warnings: NA |
############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/bbs-3.20-bioc/R/bin/R CMD check --install=check:rfaRm.install-out.txt --library=/home/biocbuild/bbs-3.20-bioc/R/site-library --timings rfaRm_1.17.0.tar.gz ### ############################################################################## ############################################################################## * using log directory ‘/home/biocbuild/bbs-3.20-bioc/meat/rfaRm.Rcheck’ * using R version 4.4.1 (2024-06-14) * using platform: x86_64-pc-linux-gnu * R was compiled by gcc (Ubuntu 11.4.0-1ubuntu1~22.04) 11.4.0 GNU Fortran (Ubuntu 11.4.0-1ubuntu1~22.04) 11.4.0 * running under: Ubuntu 22.04.4 LTS * using session charset: UTF-8 * checking for file ‘rfaRm/DESCRIPTION’ ... OK * checking extension type ... Package * this is package ‘rfaRm’ version ‘1.17.0’ * package encoding: UTF-8 * checking package namespace information ... OK * checking package dependencies ... OK * checking if this is a source package ... OK * checking if there is a namespace ... OK * checking for hidden files and directories ... OK * checking for portable file names ... OK * checking for sufficient/correct file permissions ... OK * checking whether package ‘rfaRm’ can be installed ... OK * checking installed package size ... OK * checking package directory ... OK * checking ‘build’ directory ... OK * checking DESCRIPTION meta-information ... OK * checking top-level files ... OK * checking for left-over files ... OK * checking index information ... OK * checking package subdirectories ... OK * checking code files for non-ASCII characters ... OK * checking R files for syntax errors ... OK * checking whether the package can be loaded ... OK * checking whether the package can be loaded with stated dependencies ... OK * checking whether the package can be unloaded cleanly ... OK * checking whether the namespace can be loaded with stated dependencies ... OK * checking whether the namespace can be unloaded cleanly ... OK * checking loading without being on the library search path ... OK * checking whether startup messages can be suppressed ... OK * checking dependencies in R code ... OK * checking S3 generic/method consistency ... OK * checking replacement functions ... OK * checking foreign function calls ... OK * checking R code for possible problems ... NOTE rfamSeedAlignment: no visible global function definition for ‘as’ Undefined global functions or variables: as Consider adding importFrom("methods", "as") to your NAMESPACE file (and ensure that your DESCRIPTION Imports field contains 'methods'). * checking Rd files ... OK * checking Rd metadata ... OK * checking Rd cross-references ... OK * checking for missing documentation entries ... OK * checking for code/documentation mismatches ... OK * checking Rd \usage sections ... OK * checking Rd contents ... OK * checking for unstated dependencies in examples ... OK * checking files in ‘vignettes’ ... OK * checking examples ... ERROR Running examples in ‘rfaRm-Ex.R’ failed The error most likely occurred in: > base::assign(".ptime", proc.time(), pos = "CheckExEnv") > ### Name: rfamSequenceSearch > ### Title: Performs a sequence search of the Rfam database > ### Aliases: rfamSequenceSearch > > ### ** Examples > > # Search the Rfam database for hits with a specific sequence, and store the > # results in a nested list > > searchHits <- rfamSequenceSearch("GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCAC + GAAAGUAUUUGCUUUGAUUUGGUGAAAUUCCAAAACCGACAGUAGAGUCUGGAUGAGAGAAGAUUC") Running sequence search query. This might take a long time. Error in base::strsplit(x, ...) : non-character argument Calls: rfamSequenceSearch ... lapply -> FUN -> strsplit -> strsplit -> <Anonymous> Execution halted * checking for unstated dependencies in ‘tests’ ... OK * checking tests ... Running ‘runTests.R’ ERROR Running the tests in ‘tests/runTests.R’ failed. Last 13 lines of output: 1 Test Suite : rfaRm RUnit Tests - 1 test function, 1 error, 0 failures ERROR in /tmp/RtmpR6jg3g/RLIBS_6bb422a51cc2/rfaRm/unitTests/test_searchFunctions.R: Error while sourcing /tmp/RtmpR6jg3g/RLIBS_6bb422a51cc2/rfaRm/unitTests/test_searchFunctions.R : Error in base::strsplit(x, ...) : non-character argument Test files with failing tests test_searchFunctions.R /tmp/RtmpR6jg3g/RLIBS_6bb422a51cc2/rfaRm/unitTests/test_searchFunctions.R Error in BiocGenerics:::testPackage("rfaRm") : unit tests failed for package rfaRm Execution halted * checking for unstated dependencies in vignettes ... OK * checking package vignettes ... OK * checking re-building of vignette outputs ... ERROR Error(s) in re-building vignettes: ... --- re-building ‘rfaRm.Rmd’ using rmarkdown Warning in eng_r(options) : Failed to tidy R code in chunk 'unnamed-chunk-2'. Reason: Error : The formatR package is required by the chunk option tidy = TRUE but not installed; tidy = TRUE will be ignored. Warning in eng_r(options) : Failed to tidy R code in chunk 'unnamed-chunk-3'. Reason: Error : The formatR package is required by the chunk option tidy = TRUE but not installed; tidy = TRUE will be ignored. Quitting from lines 74-83 [unnamed-chunk-3] (rfaRm.Rmd) Error: processing vignette 'rfaRm.Rmd' failed with diagnostics: non-character argument --- failed re-building ‘rfaRm.Rmd’ SUMMARY: processing the following file failed: ‘rfaRm.Rmd’ Error: Vignette re-building failed. Execution halted * checking PDF version of manual ... OK * DONE Status: 3 ERRORs, 1 NOTE See ‘/home/biocbuild/bbs-3.20-bioc/meat/rfaRm.Rcheck/00check.log’ for details.
rfaRm.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/bbs-3.20-bioc/R/bin/R CMD INSTALL rfaRm ### ############################################################################## ############################################################################## * installing to library ‘/home/biocbuild/bbs-3.20-bioc/R/site-library’ * installing *source* package ‘rfaRm’ ... ** using staged installation ** R ** inst ** byte-compile and prepare package for lazy loading ** help *** installing help indices ** building package indices ** installing vignettes ** testing if installed package can be loaded from temporary location ** testing if installed package can be loaded from final location ** testing if installed package keeps a record of temporary installation path * DONE (rfaRm)
rfaRm.Rcheck/tests/runTests.Rout.fail
R version 4.4.1 (2024-06-14) -- "Race for Your Life" Copyright (C) 2024 The R Foundation for Statistical Computing Platform: x86_64-pc-linux-gnu R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. > BiocGenerics:::testPackage("rfaRm") Linking to librsvg 2.52.5 No encoding supplied: defaulting to UTF-8. format width height colorspace matte filesize density 1 SVG 700 550 sRGB TRUE 20454 72x72 format width height colorspace matte filesize density 1 GIF 600 2056 sRGB FALSE 62234 72x72 Running sequence search query. This might take a long time. Error in base::strsplit(x, ...) : non-character argument RUNIT TEST PROTOCOL -- Mon Jul 22 03:06:11 2024 *********************************************** Number of test functions: 1 Number of errors: 1 Number of failures: 0 1 Test Suite : rfaRm RUnit Tests - 1 test function, 1 error, 0 failures ERROR in /tmp/RtmpR6jg3g/RLIBS_6bb422a51cc2/rfaRm/unitTests/test_searchFunctions.R: Error while sourcing /tmp/RtmpR6jg3g/RLIBS_6bb422a51cc2/rfaRm/unitTests/test_searchFunctions.R : Error in base::strsplit(x, ...) : non-character argument Test files with failing tests test_searchFunctions.R /tmp/RtmpR6jg3g/RLIBS_6bb422a51cc2/rfaRm/unitTests/test_searchFunctions.R Error in BiocGenerics:::testPackage("rfaRm") : unit tests failed for package rfaRm Execution halted
rfaRm.Rcheck/rfaRm-Ex.timings
name | user | system | elapsed | |
rfamConsensusSecondaryStructure | 0.387 | 0.008 | 2.494 | |
rfamCovarianceModel | 0.138 | 0.045 | 0.703 | |
rfamFamilyAccessionToID | 0.039 | 0.004 | 0.133 | |
rfamFamilyIDToAccession | 0.020 | 0.000 | 0.113 | |
rfamFamilySummary | 0.155 | 0.000 | 0.699 | |
rfamPDBMapping | 0.106 | 0.084 | 0.607 | |
rfamSecondaryStructurePlot | 5.941 | 0.076 | 6.418 | |
rfamSecondaryStructureXMLSVG | 0.056 | 0.008 | 0.586 | |
rfamSeedAlignment | 0.446 | 0.132 | 1.617 | |
rfamSeedTree | 0.086 | 0.004 | 0.455 | |
rfamSeedTreeImage | 0.104 | 0.028 | 0.524 | |
rfamSequenceRegions | 0.138 | 0.012 | 1.303 | |