Changqing Wang
| Snapshot Date: 2024-05-29 11:04:14 -0400 (Wed, 29 May 2024) |
| git_url: https://git.bioconductor.org/packages/FLAMES |
| git_branch: devel |
| git_last_commit: 7d0c263 |
| git_last_commit_date: 2024-04-30 11:35:54 -0400 (Tue, 30 Apr 2024) |
| Back to Multiple platform build/check report for BioC 3.20: simplified long |
|
This page was generated on 2024-05-30 12:34:34 -0400 (Thu, 30 May 2024).
| Hostname | OS | Arch (*) | R version | Installed pkgs |
|---|---|---|---|---|
| nebbiolo2 | Linux (Ubuntu 22.04.3 LTS) | x86_64 | 4.4.0 RC (2024-04-16 r86468) -- "Puppy Cup" | 4669 |
| palomino4 | Windows Server 2022 Datacenter | x64 | 4.4.0 RC (2024-04-16 r86468 ucrt) -- "Puppy Cup" | 4404 |
| merida1 | macOS 12.7.4 Monterey | x86_64 | 4.4.0 Patched (2024-04-24 r86482) -- "Puppy Cup" | 4431 |
| kjohnson1 | macOS 13.6.6 Ventura | arm64 | 4.4.0 Patched (2024-04-24 r86482) -- "Puppy Cup" | 4384 |
| Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X | ||||
| Package 703/2233 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
| FLAMES 1.11.0 (landing page) Changqing Wang
| nebbiolo2 | Linux (Ubuntu 22.04.3 LTS) / x86_64 | OK | OK | OK | | ||||||||
| palomino4 | Windows Server 2022 Datacenter / x64 | ... NOT SUPPORTED ... | ||||||||||||
| merida1 | macOS 12.7.4 Monterey / x86_64 | OK | OK | OK | OK | | ||||||||
| kjohnson1 | macOS 13.6.6 Ventura / arm64 | ERROR | ERROR | skipped | skipped | |||||||||
|
To the developers/maintainers of the FLAMES package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
| Package: FLAMES |
| Version: 1.11.0 |
| Command: /home/biocbuild/bbs-3.20-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.20-bioc/R/site-library --timings FLAMES_1.11.0.tar.gz |
| StartedAt: 2024-05-29 20:00:41 -0400 (Wed, 29 May 2024) |
| EndedAt: 2024-05-29 20:10:47 -0400 (Wed, 29 May 2024) |
| EllapsedTime: 606.2 seconds |
| RetCode: 0 |
| Status: OK |
| CheckDir: FLAMES.Rcheck |
| Warnings: 0 |
##############################################################################
##############################################################################
###
### Running command:
###
### /home/biocbuild/bbs-3.20-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.20-bioc/R/site-library --timings FLAMES_1.11.0.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/home/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck’
* using R version 4.4.0 RC (2024-04-16 r86468)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
gcc (Ubuntu 11.4.0-1ubuntu1~22.04) 11.4.0
GNU Fortran (Ubuntu 11.4.0-1ubuntu1~22.04) 11.4.0
* running under: Ubuntu 22.04.4 LTS
* using session charset: UTF-8
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* checking extension type ... Package
* this is package ‘FLAMES’ version ‘1.11.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
.BBSoptions
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
Non-staged installation was used
See ‘/home/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘g++ (Ubuntu 11.4.0-1ubuntu1~22.04) 11.4.0’
* checking C++ specification ... OK
Not all R platforms support C++17
* checking installed package size ... NOTE
installed size is 5.9Mb
sub-directories of 1Mb or more:
data 2.7Mb
libs 1.4Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... NOTE
Package listed in more than one of Depends, Imports, Suggests, Enhances:
‘txdbmaker’
A package should be listed in only one of these fields.
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... NOTE
Namespace in Imports field not imported from: 'IRanges'
All declared Imports should be used.
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
find_variants_grange: no visible binding for global variable
'which_label'
find_variants_grange: no visible binding for global variable
'nucleotide'
find_variants_grange: no visible binding for global variable 'pos'
find_variants_grange: no visible binding for global variable 'count'
find_variants_grange: no visible binding for global variable
'counts_no_ins'
find_variants_grange: no visible binding for global variable 'ref'
generate_sc_sce: no visible binding for global variable 'FSM_match'
homopolymer_pct : <anonymous>: no visible binding for global variable
'Freq'
homopolymer_pct : <anonymous>: no visible binding for global variable
'pct'
plot_coverage: no visible binding for global variable 'x'
plot_coverage: no visible binding for global variable 'transcript'
plot_coverage: no visible binding for global variable 'length_bin'
plot_demultiplex: no visible binding for global variable 'Freq'
plot_demultiplex: no visible binding for global variable '.'
plot_demultiplex: no visible binding for global variable 'x'
plot_demultiplex: no visible binding for global variable
'FlankEditDist'
plot_demultiplex: no visible binding for global variable 'n'
plot_demultiplex: no visible binding for global variable
'BarcodeEditDist'
plot_flagstat: no visible global function definition for 'everything'
plot_flagstat: no visible binding for global variable 'name'
plot_flagstat: no visible binding for global variable 'value'
sc_DTU_analysis: no visible binding for global variable 'FSM_match'
sc_DTU_analysis: no visible binding for global variable 'gene_id'
sc_DTU_analysis: no visible binding for global variable '.'
sc_DTU_analysis: no visible binding for global variable 'cell_id'
sc_DTU_analysis: no visible binding for global variable 'cnt'
sc_DTU_analysis: no visible binding for global variable 'tr_id'
sc_DTU_analysis: no visible binding for global variable 'label'
sc_DTU_analysis : filter_tr: no visible binding for global variable
'gene_id'
sc_DTU_analysis : filter_tr: no visible global function definition for
'all_vars'
sc_DTU_analysis : filter_tr: no visible binding for global variable '.'
sc_DTU_analysis: no visible global function definition for 'all_vars'
sc_heatmap_expression: no visible binding for global variable
'transcript_id'
sc_heatmap_expression: no visible binding for global variable 'gene_id'
sc_heatmap_expression : group_annotation: no visible binding for global
variable 'heatmap_annotation_colors'
sc_mutations: no visible binding for global variable 'mutation_index'
sc_mutations: no visible binding for global variable 'bam_index'
sc_umap_expression: no visible binding for global variable
'transcript_id'
sc_umap_expression: no visible binding for global variable 'gene_id'
sc_umap_expression: no visible binding for global variable 'x'
sc_umap_expression: no visible binding for global variable 'y'
sc_umap_expression : plot_idx: no visible binding for global variable
'x'
sc_umap_expression : plot_idx: no visible binding for global variable
'y'
transcript_coverage: no visible binding for global variable 'mat'
variant_count_tb: no visible binding for global variable 'barcode'
variant_count_tb: no visible binding for global variable 'allele_count'
variant_count_tb: no visible binding for global variable
'cell_total_reads'
Undefined global functions or variables:
. BarcodeEditDist FSM_match FlankEditDist Freq all_vars allele_count
bam_index barcode cell_id cell_total_reads cnt count counts_no_ins
everything gene_id heatmap_annotation_colors label length_bin mat
mutation_index n name nucleotide pct pos ref tr_id transcript
transcript_id value which_label x y
* checking Rd files ... NOTE
checkRd: (-1) bulk_long_pipeline.Rd:80-81: Lost braces in \itemize; meant \describe ?
checkRd: (-1) bulk_long_pipeline.Rd:82-83: Lost braces in \itemize; meant \describe ?
checkRd: (-1) bulk_long_pipeline.Rd:84-86: Lost braces in \itemize; meant \describe ?
checkRd: (-1) bulk_long_pipeline.Rd:40: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) bulk_long_pipeline.Rd:41: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) bulk_long_pipeline.Rd:42: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) bulk_long_pipeline.Rd:43: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) bulk_long_pipeline.Rd:44: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) bulk_long_pipeline.Rd:45: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) create_config.Rd:14: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:15: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:20: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:21: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:22: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:23: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:24: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:25: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:26: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:27: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:28: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:29: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:30: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:31: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:32: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:33: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:34: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:35: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:36: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:37: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:38: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:39: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:40: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:41: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:42: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:43: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:44: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:45: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:46: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_DTU_analysis.Rd:18: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:19: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:20: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:21: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:22: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:23: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:24: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_multisample_pipeline.Rd:88-89: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_multisample_pipeline.Rd:90-91: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_multisample_pipeline.Rd:92-94: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_pipeline.Rd:94-95: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_pipeline.Rd:96-97: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_pipeline.Rd:98-100: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_pipeline.Rd:53: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_pipeline.Rd:54: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_pipeline.Rd:55: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_pipeline.Rd:56: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_pipeline.Rd:57: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_pipeline.Rd:58: Lost braces in \itemize; \value handles \item{}{} directly
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... NOTE
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/home/biocbuild/bbs-3.20-bioc/R/site-library/FLAMES/libs/FLAMES.so’:
Found ‘abort’, possibly from ‘abort’ (C)
Found ‘exit’, possibly from ‘exit’ (C)
Found ‘stderr’, possibly from ‘stderr’ (C)
Found ‘stdout’, possibly from ‘stdout’ (C)
Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.
See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
user system elapsed
sc_heatmap_expression 35.432 2.374 36.505
sc_umap_expression 28.550 1.350 28.594
sc_reduce_dims 18.653 1.746 19.078
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
Running ‘testthat.R’
OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... OK
* checking PDF version of manual ... OK
* DONE
Status: 9 NOTEs
See
‘/home/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck/00check.log’
for details.
FLAMES.Rcheck/00install.out
##############################################################################
##############################################################################
###
### Running command:
###
### /home/biocbuild/bbs-3.20-bioc/R/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################
* installing to library ‘/home/biocbuild/bbs-3.20-bioc/R/site-library’
* installing *source* package ‘FLAMES’ ...
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘g++ (Ubuntu 11.4.0-1ubuntu1~22.04) 11.4.0’
using C++17
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c RcppExports.cpp -o RcppExports.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c RcppFunctions.cpp -o RcppFunctions.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c classes/BamRecord.cpp -o classes/BamRecord.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c classes/GFFRecord.cpp -o classes/GFFRecord.o
In file included from classes/GFFRecord.cpp:8:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
255 | for (int i = 0; i < s.size(); i++) {
| ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
In file included from classes/GeneAnnotationParser.cpp:15:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
255 | for (int i = 0; i < s.size(); i++) {
| ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c classes/Isoforms.cpp -o classes/Isoforms.o
In file included from classes/Isoforms.cpp:16:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
255 | for (int i = 0; i < s.size(); i++) {
| ~~^~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::update_all_splice()’:
classes/Isoforms.cpp:233:35: warning: comparison of integer expressions of different signedness: ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
233 | if (blocks.size() >= (int)this->Min_sup_cnt) {
| ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::filter_TSS_TES(std::ofstream&, DoubleJunctions, float)’:
classes/Isoforms.cpp:368:33: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
368 | if ((left_counts.size() < (int)this->Min_sup_cnt) ||
| ~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:369:38: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare]
369 | (right_counts.size() < (int)this->Min_sup_cnt)) {
| ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp: In member function ‘void Isoforms::match_known_annotation(const std::unordered_map<std::__cxx11::basic_string<char>, Junctions>&, const std::unordered_map<std::__cxx11::basic_string<char>, Pos>&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&, GeneBlocks, std::unordered_map<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> >)’:
classes/Isoforms.cpp:662:51: warning: comparison of integer expressions of different signedness: ‘int’ and ‘const long unsigned int’ [-Wsign-compare]
662 | for (int j = 0; j < std::min(raw_iso_key.size() - 1, junction.junctions.size()); j++) {
| ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:713:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
713 | for (int i = 0; i < new_exons.size(); ++i) {
| ~~^~~~~~~~~~~~~~~~~~
classes/Isoforms.cpp:725:46: warning: comparisons like ‘X<=Y<=Z’ do not have their mathematical meaning [-Wparentheses]
725 | } else if (0 < i < raw_iso_key.size() - 1) { // a site from the middle somewhere
| ~~^~~
classes/Isoforms.cpp: In member function ‘std::string Isoforms::isoform_to_gff3(float)’:
classes/Isoforms.cpp:1140:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
1140 | for (int i = 0; i < exons.size(); i+=2) {
| ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c classes/junctions.cpp -o classes/junctions.o
In file included from classes/junctions.cpp:12:
classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const string&)’:
classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
255 | for (int i = 0; i < s.size(); i++) {
| ~~^~~~~~~~~~
classes/junctions.cpp: In function ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> > get_gene_flat(const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::__cxx11::basic_string<char> > >&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&)’:
classes/junctions.cpp:162:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
162 | for (int i = 1; i < exons.size(); i++) {
| ~~^~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
main-functions/flexiplex.cpp: In function ‘unsigned int edit_distance(const string&, const string&, unsigned int&, int)’:
main-functions/flexiplex.cpp:119:21: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
119 | if (min_value <= max_editd)
| ~~~~~~~~~~^~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘Barcode get_barcode(const string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
main-functions/flexiplex.cpp:225:19: warning: comparison of integer expressions of different signedness: ‘int’ and ‘__gnu_cxx::__alloc_traits<std::allocator<long unsigned int>, long unsigned int>::value_type’ {aka ‘long unsigned int’} [-Wsign-compare]
225 | if (i_pattern >= subpattern_ends[i_subpattern]) {
main-functions/flexiplex.cpp:286:22: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
286 | if (editDistance == barcode.editd) {
| ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:288:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
288 | } else if (editDistance < barcode.editd &&
| ~~~~~~~~~~~~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:289:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
289 | editDistance <= barcode_max_editd) { // if best so far, update
| ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘std::vector<Barcode> big_barcode_search(const string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
main-functions/flexiplex.cpp:351:29: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
351 | if (barcode.flank_end == std::string::npos) {
| ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘void print_stats(const string&, const std::vector<Barcode>&, std::ostream&)’:
main-functions/flexiplex.cpp:376:38: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
376 | << (barcode.flank_end == std::string::npos ? "True" : "False")
| ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘void print_read(const string&, const string&, const string&, const std::vector<Barcode>&, std::ofstream&, std::unordered_set<std::__cxx11::basic_string<char> >&, bool)’:
main-functions/flexiplex.cpp:401:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
401 | for (int b = 0; b < vec_bc.size(); b++) {
| ~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:411:32: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
411 | if (vec_bc.at(b).flank_end == std::string::npos) {
| ~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:416:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
416 | for (int f = 0; f < vec_bc.size(); f++) {
| ~~^~~~~~~~~~~~~~~
main-functions/flexiplex.cpp: In function ‘int flexiplex_cpp(Rcpp::String, Rcpp::String, bool, int, int, Rcpp::StringVector, Rcpp::String, Rcpp::String, Rcpp::String, int)’:
main-functions/flexiplex.cpp:635:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<std::vector<SearchResult> >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
635 | for (int t = 0; t < sr_v.size();
| ~~^~~~~~~~~~~~~
main-functions/flexiplex.cpp:640:25: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<SearchResult>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
640 | for (int r = 0; r < sr_v[t].size(); r++) { // loop over the reads
| ~~^~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:642:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
642 | for (int b = 0; b < sr_v[t][r].vec_bc_for.size(); b++)
| ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
main-functions/flexiplex.cpp:644:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
644 | for (int b = 0; b < sr_v[t][r].vec_bc_rev.size(); b++)
| ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
main-functions/get_transcript_seq.cpp: In function ‘void write_fa(const string&, const string&, const string&, int)’:
main-functions/get_transcript_seq.cpp:87:14: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
87 | while (i < seq.size()) {
| ~~^~~~~~~~~~~~
main-functions/get_transcript_seq.cpp:88:26: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
88 | if (i + wrap_len > seq.size()) {
| ~~~~~~~~~~~~~^~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
In file included from main-functions/group_bam2isoform.cpp:18:
main-functions/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const string&)’:
main-functions/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
255 | for (int i = 0; i < s.size(); i++) {
| ~~^~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c tests/test-junctions.cpp -o tests/test-junctions.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c tests/test-parsing.cpp -o tests/test-parsing.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c utility/cigars.cpp -o utility/cigars.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c utility/edit_dist.cpp -o utility/edit_dist.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c utility/fastq_utils.cpp -o utility/fastq_utils.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c utility/ssw/ssw_cpp.cpp -o utility/ssw/ssw_cpp.o
gcc -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c utility/bam.c -o utility/bam.o
gcc -I"/home/biocbuild/bbs-3.20-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/zlibbioc/include' -I'/home/biocbuild/bbs-3.20-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -c utility/ssw/ssw.c -o utility/ssw/ssw.o
g++ -std=gnu++17 -shared -L/home/biocbuild/bbs-3.20-bioc/R/lib -L/usr/local/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edit_dist.o utility/fastq_utils.o utility/edlib-1.2.7/edlib.o utility/ssw/ssw_cpp.o utility/bam.o utility/ssw/ssw.o -pthread /home/biocbuild/bbs-3.20-bioc/R/site-library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -L/home/biocbuild/bbs-3.20-bioc/R/lib -lR
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
installing to /home/biocbuild/bbs-3.20-bioc/R/site-library/FLAMES/libs
** R
** data
*** moving datasets to lazyload DB
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)
FLAMES.Rcheck/tests/testthat.Rout
R version 4.4.0 RC (2024-04-16 r86468) -- "Puppy Cup"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
>
> library(testthat)
> library(FLAMES)
>
> test_check("FLAMES")
Writing configuration parameters to: /tmp/RtmpZ1J9nO/file1f19e364e82fd/config_file_2038243.json
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpZ1J9nO/bc_allow.tsv
Number of known barcodes: 143
Searching for barcodes...
Number of reads processed: 393
Number of reads where a barcode was found: 368
Number of reads where more than one barcode was found: 4
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 4 ]
>
> proc.time()
user system elapsed
21.910 1.053 22.952
FLAMES.Rcheck/FLAMES-Ex.timings
| name | user | system | elapsed | |
| annotation_to_fasta | 2.649 | 0.084 | 2.733 | |
| blaze | 0.435 | 0.075 | 2.481 | |
| bulk_long_pipeline | 0.791 | 0.085 | 1.859 | |
| combine_sce | 1.508 | 0.280 | 1.789 | |
| create_config | 0.000 | 0.007 | 0.008 | |
| create_sce_from_dir | 0.121 | 0.020 | 0.142 | |
| create_se_from_dir | 0.663 | 0.073 | 1.270 | |
| cutadapt | 0 | 0 | 0 | |
| filter_annotation | 0.67 | 0.12 | 0.79 | |
| find_barcode | 0.104 | 0.016 | 0.120 | |
| find_isoform | 0.510 | 0.028 | 0.922 | |
| find_variants | 0.128 | 0.020 | 0.465 | |
| get_GRangesList | 0.643 | 0.045 | 1.119 | |
| minimap2_align | 0.788 | 0.053 | 1.265 | |
| minimap2_realign | 1.055 | 0.061 | 1.561 | |
| parse_gff_tree | 0.472 | 0.008 | 0.569 | |
| plot_coverage | 0.774 | 0.101 | 1.454 | |
| plot_demultiplex | 0.487 | 0.124 | 0.611 | |
| quantify_transcript | 1.998 | 0.276 | 2.784 | |
| sc_DTU_analysis | 0.131 | 0.017 | 0.148 | |
| sc_heatmap_expression | 35.432 | 2.374 | 36.505 | |
| sc_long_multisample_pipeline | 1.192 | 0.076 | 1.269 | |
| sc_long_pipeline | 0.125 | 0.018 | 0.143 | |
| sc_mutations | 0.146 | 0.005 | 0.275 | |
| sc_reduce_dims | 18.653 | 1.746 | 19.078 | |
| sc_umap_expression | 28.550 | 1.350 | 28.594 | |
| sys_which | 0.003 | 0.000 | 0.003 | |