Package: trena

Version: 1.2.0

Command: /home/biocbuild/bbs-3.7-bioc/R/bin/R CMD check --install=check:trena.install-out.txt --library=/home/biocbuild/bbs-3.7-bioc/R/library --no-vignettes --timings trena_1.2.0.tar.gz

StartedAt: 2018-10-16 04:17:13 -0400 (Tue, 16 Oct 2018)

EndedAt: 2018-10-16 04:26:48 -0400 (Tue, 16 Oct 2018)

EllapsedTime: 575.0 seconds

RetCode: 0

Status:  OK

CheckDir: trena.Rcheck

Warnings: 0

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.7-bioc/R/bin/R CMD check --install=check:trena.install-out.txt --library=/home/biocbuild/bbs-3.7-bioc/R/library --no-vignettes --timings trena_1.2.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.7-bioc/meat/trena.Rcheck’
* using R version 3.5.1 Patched (2018-07-12 r74967)
* using platform: x86_64-pc-linux-gnu (64-bit)
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘trena/DESCRIPTION’ ... OK
* checking extension type ... Package
* this is package ‘trena’ version ‘1.2.0’
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
  .BBSoptions
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘trena’ can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... OK
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking include directives in Makefiles ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘runTests.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes in ‘inst/doc’ ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 1 NOTE
See
  ‘/home/biocbuild/bbs-3.7-bioc/meat/trena.Rcheck/00check.log’
for details.

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.7-bioc/R/bin/R CMD INSTALL trena
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/bbs-3.7-bioc/R/library’
* installing *source* package ‘trena’ ...
** R
** inst
** byte-compile and prepare package for lazy loading
See system.file("LICENSE", package="MotifDb") for use restrictions.
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded
See system.file("LICENSE", package="MotifDb") for use restrictions.
* DONE (trena)

R version 3.5.1 Patched (2018-07-12 r74967) -- "Feather Spray"
Copyright (C) 2018 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu (64-bit)

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> require(trena) || stop("unable to load trena Package")
Loading required package: trena
Loading required package: glmnet
Loading required package: Matrix
Loading required package: foreach
Loaded glmnet 2.0-16

Loading required package: MotifDb
Loading required package: BiocGenerics
Loading required package: parallel

Attaching package: 'BiocGenerics'

The following objects are masked from 'package:parallel':

    clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
    clusterExport, clusterMap, parApply, parCapply, parLapply,
    parLapplyLB, parRapply, parSapply, parSapplyLB

The following objects are masked from 'package:Matrix':

    colMeans, colSums, rowMeans, rowSums, which

The following objects are masked from 'package:stats':

    IQR, mad, sd, var, xtabs

The following objects are masked from 'package:base':

    Filter, Find, Map, Position, Reduce, anyDuplicated, append,
    as.data.frame, basename, cbind, colMeans, colSums, colnames,
    dirname, do.call, duplicated, eval, evalq, get, grep, grepl,
    intersect, is.unsorted, lapply, lengths, mapply, match, mget,
    order, paste, pmax, pmax.int, pmin, pmin.int, rank, rbind,
    rowMeans, rowSums, rownames, sapply, setdiff, sort, table, tapply,
    union, unique, unsplit, which, which.max, which.min

Loading required package: S4Vectors
Loading required package: stats4

Attaching package: 'S4Vectors'

The following object is masked from 'package:Matrix':

    expand

The following object is masked from 'package:base':

    expand.grid

Loading required package: IRanges
Loading required package: Biostrings
Loading required package: XVector

Attaching package: 'Biostrings'

The following object is masked from 'package:base':

    strsplit

See system.file("LICENSE", package="MotifDb") for use restrictions.

[1] TRUE
> BiocGenerics:::testPackage('trena')
[1] --- test_BayesSpikeSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.bayesSpike
[1] --- test_nOrderings
[1] --- test_BayesSpikeSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.bayesSpike
[1] --- test_nOrderings
[1] --- test_CandidateFilter
[1] --- test_CandidateFilter
[1] --- test_EnsembleSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.ensemble
[1] --- test_selectedSolversOnly
[1] --- test_pcaError
[1] --- test_getSolverNames
[1] --- test_oneSolver
[1] --- test_invalidSolvers
[1] --- test_EnsembleSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, targetGene = targetGene, candidateRegulators = candidateRegulators,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.ensemble
[1] --- test_getSolverNames
[1] --- test_invalidSolvers
[1] --- test_oneSolver
[1] --- test_pcaError
[1] --- test_selectedSolversOnly
[1] --- test_FootprintFilter.byRegion
[1] --- test_FootprintFilter.byTwoRegions
[1] --- test_FootprintFilter.byRegion
[1] --- test_FootprintFilter.byTwoRegions
Loading required package: DBI
[1] --- test_parseDatabaseUri
[1] --- test_constructor
[1] --- test_getGtfGeneBioTypes
[1] --- test_getGtfMoleculeTypes
[1] --- test_getChromLoc
[1] --- test_getGenePromoterRegion
[1] --- test_getFootprintsInRegion
[1] --- test_getFootprintsInRegionWithVariants
[1] --- test_getFootprintsForGene
[1] --- test_constructor
[1] --- test_getChromLoc
[1] --- test_getFootprintsForGene
[1] --- test_getFootprintsInRegion
[1] --- test_getFootprintsInRegionWithVariants
[1] --- test_getGenePromoterRegion
[1] --- test_getGtfGeneBioTypes
[1] --- test_getGtfMoleculeTypes
[1] --- test_parseDatabaseUri
[1] --- test_directMode
Loading required package: org.Hs.eg.db
Loading required package: AnnotationDbi
Loading required package: Biobase
Welcome to Bioconductor

    Vignettes contain introductory material; view with
    'browseVignettes()'. To cite Bioconductor, see
    'citation("Biobase")', and for packages 'citation("pkgname")'.

[1] --- test_directMode
[1] --- test_LassoPvSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.lassopv
[1] --- test_LassoPvSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.lassopv
[1] --- test_LassoSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_developAndFitDummyTestData
[1] --- test_fitDummyData
[1] --- test_ampAD.mef2c.154tfs.278samples.lasso
[1] --- test_alpha.lasso
Warning: call dbDisconnect() when finished working with a connection
[1] --- test_lambda.lasso
[1] --- test_keep.metrics.lasso
[1] --- test_scalePredictorPenalties.lasso
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_LassoSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_alpha.lasso
[1] --- test_ampAD.mef2c.154tfs.278samples.lasso
[1] --- test_developAndFitDummyTestData
[1] --- test_fitDummyData
[1] --- test_keep.metrics.lasso
[1] --- test_lambda.lasso
[1] --- test_scalePredictorPenalties.lasso
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_.getScoredMotifs
[1] --- test_.injectSnp
[1] --- test_basicConstructor
[1] --- test_bugInStartEndOfMinusStrandHits
[1] --- test_findMatchesByChromosomalRegion
[1] best$seq: ACCAGCATGCAAATTAGACAA
[1] --- test_findMatchesByChromosomalRegion.twoAlternateAlleles
[1] --- test_findMatchesByChromosomalRegion_contrastReferenceWithVariant
[1] --- test_findMatchesByMultipleChromosomalRegions
[1] --- test_getSequence
[1] --- test_getSequenceWithVariants
[1] --- test_noMatch
[1] --- test_PearsonSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.pearson
[1] --- test_PearsonSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.pearson
[1] --- test_RandomForestSolverConstructor
[1] --- test_RandomForestSolverFewCandidates
[1] --- test_ampAD.mef2c.154tfs.278samples.randomForest
[1] --- test_RandomForestSolverConstructor
[1] --- test_RandomForestSolverFewCandidates
[1] --- test_ampAD.mef2c.154tfs.278samples.randomForest
[1] --- test_RidgeSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.ridge
[1] --- test_alpha.ridge
[1] --- test_lambda.ridge
[1] --- test_keep.metrics.ridge
[1] --- test_RidgeSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_alpha.ridge
[1] --- test_ampAD.mef2c.154tfs.278samples.ridge
[1] --- test_keep.metrics.ridge
[1] --- test_lambda.ridge
[1] --- test_getAssayData
Warning in Solver(mtx, "gene1", c("gene2", "gene3")) :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_getTarget
[1] --- test_getRegulators
[1] --- test_eliminateSelfTFs
[1] --- test_MatrixWarnings
[1] --- test_TargetAndRegulatorWarnings
[1] --- test_MatrixWarnings
[1] --- test_TargetAndRegulatorWarnings
[1] --- test_eliminateSelfTFs
[1] --- test_getAssayData
[1] --- test_getRegulators
[1] --- test_getTarget
[1] --- test_SpearmanSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.spearman
[1] --- test_SpearmanSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.spearman
[1] --- test_SqrtLassoSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.sqrtlasso
[1] --- test_lambda.sqrtlasso
[1] --- test_nCores.sqrtlasso
[1] --- test_SqrtLassoSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.sqrtlasso
[1] --- test_lambda.sqrtlasso
[1] --- test_nCores.sqrtlasso
[1] --- test_basicConstructor
[1] --- test_getRegulatoryRegions_oneFootprintSource
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.7-bioc/R/library/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] --- test_getRegulatoryRegions_encodeDHS
[1] calling HumanDHSFilter, span: 5
[1] calling HumanDHSFilter, span: 201
[1] --- test_getRegulatoryRegions_twoFootprintSources
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.7-bioc/R/library/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.7-bioc/R/library/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] --- test_createGeneModel
[1] --- test_getProximalPromoterHuman
[1] --- test_getProximalPromoterMouse
[1] --- test_assessSnp
[1] error, unrecognized variant name: 'rsBogus'
[1] --- test_assessSnp_allTypesWithDeltas
[1] --- test_basicConstructor
[1] --- test_createGeneModel
[1] --- test_getProximalPromoterHuman
[1] --- test_getProximalPromoterMouse
[1] --- test_getRegulatoryRegions_encodeDHS
[1] calling HumanDHSFilter, span: 5
[1] calling HumanDHSFilter, span: 201
[1] --- test_getRegulatoryRegions_oneFootprintSource
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.7-bioc/R/library/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] --- test_getRegulatoryRegions_twoFootprintSources
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.7-bioc/R/library/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.7-bioc/R/library/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] --- test_VarianceFilter
[1] --- test_VarianceFilter


RUNIT TEST PROTOCOL -- Tue Oct 16 04:26:44 2018 
*********************************************** 
Number of test functions: 85 
Number of errors: 0 
Number of failures: 0 

 
1 Test Suite : 
trena RUnit Tests - 85 test functions, 0 errors, 0 failures
Number of test functions: 85 
Number of errors: 0 
Number of failures: 0 
Warning messages:
1: In Solver(mtx.assay = mtx.assay, targetGene = targetGene, candidateRegulators = candidateRegulators,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
2: In Solver(mtx.assay = mtx.assay, targetGene = targetGene, candidateRegulators = candidateRegulators,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
3: In Solver(mtx.assay = mtx.assay, targetGene = targetGene, candidateRegulators = candidateRegulators,  :
  Target gene mean expression is in the bottom 10% of all genes in the assay matrix
> 
> proc.time()
   user  system elapsed 
292.692  19.928 318.251 

name	user	system	elapsed
BayesSpikeSolver	0.020	0.000	0.041
CandidateFilter-class	0.004	0.000	0.001
EnsembleSolver	0.02	0.00	0.02
FootprintFilter-class	0.004	0.000	0.001
GeneOntologyFilter-class	0.056	0.000	0.064
HumanDHSFilter-class	0.000	0.000	0.002
LassoPVSolver	0.608	0.000	0.610
LassoSolver	0.012	0.000	0.012
MotifMatcher-class	0.136	0.000	0.135
PearsonSolver	0.012	0.000	0.011
RandomForestSolver	0.012	0.000	0.010
RidgeSolver	0.004	0.000	0.001
Solver-class	0.008	0.000	0.009
SpearmanSolver	0.012	0.000	0.011
SqrtLassoSolver	0.008	0.004	0.012
Trena-class	0.004	0.000	0.001
VarianceFilter-class	0.004	0.000	0.006
assessSnp	0.000	0.000	0.001
createGeneModel	0.000	0.000	0.003
findMatchesByChromosomalRegion	0	0	0
getAssayData	0.008	0.004	0.010
getAvailableSolvers	0.000	0.000	0.001
getCandidates-FootprintFilter-method	0.000	0.000	0.001
getCandidates-GeneOntologyFilter-method	0.672	0.028	0.717
getCandidates-HumanDHSFilter-method	0.000	0.000	0.002
getCandidates-VarianceFilter-method	0.020	0.000	0.022
getChromLoc	0.020	0.000	0.024
getEncodeRegulatoryTableNames-HumanDHSFilter	0.000	0.000	0.002
getFootprintsForGene	0.016	0.000	0.016
getFootprintsInRegion	0.024	0.000	0.021
getGeneModelTableColumnNames	0.000	0.000	0.002
getGenePromoterRegion	0.012	0.000	0.016
getGtfGeneBioTypes	0.012	0.000	0.014
getGtfMoleculeTypes	0.008	0.004	0.013
getPfms	0.128	0.000	0.129
getPromoterRegionsAllGenes	0.036	0.000	0.036
getProximalPromoter	0.000	0.000	0.001
getRegulators	0.012	0.000	0.011
getRegulatoryChromosomalRegions	0.916	0.008	4.593
getRegulatoryRegions	0.004	0.000	0.002
getRegulatoryTableColumnNames	0.000	0.000	0.001
getSequence	0.000	0.000	0.001
getSolverNames	0.016	0.004	0.020
getTarget	0.012	0.000	0.014
parseChromLocString	0.004	0.000	0.002
parseDatabaseUri	0.004	0.000	0.002
rescalePredictorWeights	0.020	0.000	0.019
show-HumanDHSFilter-method	0.000	0.000	0.001
show.BayesSpikeSolver	0.024	0.000	0.021
show.EnsembleSolver	0.016	0.000	0.017
show.LassoPVSolver	0.024	0.000	0.021
show.LassoSolver	0.012	0.000	0.013
show.MotifMatcher	0.012	0.000	0.011
show.PearsonSolver	0.016	0.000	0.014
show.RandomForestSolver	0.012	0.004	0.015
show.RidgeSolver	0.012	0.000	0.014
show.SpearmanSolver	0.008	0.004	0.014
show.SqrtLassoSolver	0.028	0.000	0.031
solve.BayesSpike	0.004	0.000	0.001
solve.Ensemble	0.000	0.000	0.001
solve.Lasso	2.112	0.044	2.184
solve.LassoPV	0.136	0.000	0.154
solve.Pearson	0.012	0.000	0.013
solve.RandomForest	3.132	0.000	3.586
solve.Ridge	3.328	0.076	3.477
solve.Spearman	0.020	0.000	0.022
solve.SqrtLasso	0.000	0.000	0.001