plotCompositePairsMatrix {ncRNAtools}R Documentation

Plots a composite matrix of base pair probabilities and paired bases

Description

Generates a heatmap-like plot to visualize the probabilities that different bases of an RNA molecule form a pair together with bases that are paired in a given secondary structure for the same RNA. The top-right half of the plot represents base pair probabilities, while in the bottom-left half paired bases are represented with black squares in the corresponding cells. Usually, a correspondance between paired bases and high-probability base pairs is observed.

Usage

plotCompositePairsMatrix(basePairProbsMatrix, pairedBases, probabilityThreshold=0.1,
                         colorPalette=paste(rainbow(7, rev=TRUE), "FF", sep=""))

Arguments

basePairProbsMatrix

A symmetric square matrix containing the probabilities of pairs between different bases. Should be in the same format as output by the generatePairsProbabilityMatrix function.

pairedBases

A dataframe indicating paired bases, in the same format as output by the findPairedBases function.

probabilityThreshold

Threshold for representing the probability that two given bases form a pair. Pairs with a probability lower than the threshold will not be considered, and their corresponding cell in the plot will be left blank.

colorPalette

Color palette to be used for displaying the probabilities above the specified threshold.

Value

A ggplot object with a representation of the base pair probability matrix and bases paired in a given secondary structure.

Examples

# Create a list with an RNA sequence, its secondary structure and a table of 
# base pair probabilities, calculated with centroidFold:

secondaryStructure <- list(sequence="GGGGAUGUAGCUCAUAUGGUAGAGCGCUCGCUUUGCAUGCGAGAGGCACAGGGUUCGAUUCCCUGCAUCUCCA", 
secondaryStructure="(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).", 
basePairProbabilities=read.csv(system.file("extdata", "exampleBasePairProbabilitiesTable.csv", package="ncRNAtools")))

# Generate a matrix of base pair probabilities:

probabilitiesMatrix <- generatePairsProbabilityMatrix(secondaryStructure$basePairProbabilities)

# Generate a dataframe with paired bases:

pairedBases <- findPairedBases(secondaryStructure$secondaryStructure, secondaryStructure$sequence)

# Plot base pair probabilities and paired bases:

plotCompositePairsMatrix(probabilitiesMatrix, pairedBases)

[Package ncRNAtools version 1.4.0 Index]