##############################################################################
##############################################################################
###
### Running command:
###
###   E:\biocbuild\bbs-3.19-bioc\R\bin\R.exe CMD check --no-multiarch --install=check:rfaRm.install-out.txt --library=E:\biocbuild\bbs-3.19-bioc\R\library --no-vignettes --timings rfaRm_1.16.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory 'E:/biocbuild/bbs-3.19-bioc/meat/rfaRm.Rcheck'
* using R version 4.4.1 (2024-06-14 ucrt)
* using platform: x86_64-w64-mingw32
* R was compiled by
    gcc.exe (GCC) 13.2.0
    GNU Fortran (GCC) 13.2.0
* running under: Windows Server 2022 x64 (build 20348)
* using session charset: UTF-8
* using option '--no-vignettes'
* checking for file 'rfaRm/DESCRIPTION' ... OK
* checking extension type ... Package
* this is package 'rfaRm' version '1.16.0'
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking whether package 'rfaRm' can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking 'build' directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking whether startup messages can be suppressed ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
rfamSeedAlignment: no visible global function definition for 'as'
Undefined global functions or variables:
  as
Consider adding
  importFrom("methods", "as")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking files in 'vignettes' ... OK
* checking examples ... ERROR
Running examples in 'rfaRm-Ex.R' failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: rfamSequenceSearch
> ### Title: Performs a sequence search of the Rfam database
> ### Aliases: rfamSequenceSearch
> 
> ### ** Examples
> 
> # Search the Rfam database for hits with a specific sequence, and store the
> # results in a nested list
> 
> searchHits <- rfamSequenceSearch("GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCAC
+ GAAAGUAUUUGCUUUGAUUUGGUGAAAUUCCAAAACCGACAGUAGAGUCUGGAUGAGAGAAGAUUC")
Running sequence search query. This might take a long time.
Error in base::strsplit(x, ...) : non-character argument
Calls: rfamSequenceSearch ... lapply -> FUN -> strsplit -> strsplit -> <Anonymous>
Execution halted
* checking for unstated dependencies in 'tests' ... OK
* checking tests ...
  Running 'runTests.R'
 ERROR
Running the tests in 'tests/runTests.R' failed.
Last 13 lines of output:
  
   
  1 Test Suite : 
  rfaRm RUnit Tests - 1 test function, 1 error, 0 failures
  ERROR in E:/biocbuild/bbs-3.19-bioc/tmpdir/RtmpKsRhza/RLIBS_ecc410045fae/rfaRm/unitTests/test_searchFunctions.R: Error while sourcing  E:/biocbuild/bbs-3.19-bioc/tmpdir/RtmpKsRhza/RLIBS_ecc410045fae/rfaRm/unitTests/test_searchFunctions.R : Error in base::strsplit(x, ...) : non-character argument
  
  Test files with failing tests
  
     test_searchFunctions.R 
       E:/biocbuild/bbs-3.19-bioc/tmpdir/RtmpKsRhza/RLIBS_ecc410045fae/rfaRm/unitTests/test_searchFunctions.R 
  
  
  Error in BiocGenerics:::testPackage("rfaRm") : 
    unit tests failed for package rfaRm
  Execution halted
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 2 ERRORs, 1 NOTE
See
  'E:/biocbuild/bbs-3.19-bioc/meat/rfaRm.Rcheck/00check.log'
for details.