Back to the "Multiple platform build/check report"

Package 108/133HostnameOS / ArchBUILDCHECKBUILD BIN
PWMEnrich.Dmelanogaster.background 2.0.0
Robert Stojnic
Snapshot Date: 2013-03-24 09:15:27 -0700 (Sun, 24 Mar 2013)
URL: https://hedgehog.fhcrc.org/bioc-data/trunk/experiment/pkgs/PWMEnrich.Dmelanogaster.background
Last Changed Rev: 2235 / Revision: 2286
Last Changed Date: 2013-03-08 10:19:01 -0800 (Fri, 08 Mar 2013)
lamb1 Linux (openSUSE 12.1) / x86_64  OK  ERROR 
moscato1 Windows Server 2008 R2 Enterprise SP1 (64-bit) / x64  OK [ ERROR ] OK 
perceval Mac OS X Leopard (10.5.8) / i386  OK  ERROR  OK 

Summary

Package: PWMEnrich.Dmelanogaster.background
Version: 2.0.0
Command: rm -rf PWMEnrich.Dmelanogaster.background.buildbin-libdir && mkdir PWMEnrich.Dmelanogaster.background.buildbin-libdir && D:\biocbld\bbs-2.11-bioc\R\bin\R.exe CMD INSTALL --build --merge-multiarch --library=PWMEnrich.Dmelanogaster.background.buildbin-libdir PWMEnrich.Dmelanogaster.background_2.0.0.tar.gz >PWMEnrich.Dmelanogaster.background-install.out 2>&1 && D:\biocbld\bbs-2.11-bioc\R\bin\R.exe CMD check --library=PWMEnrich.Dmelanogaster.background.buildbin-libdir --install="check:PWMEnrich.Dmelanogaster.background-install.out" --force-multiarch --no-vignettes --timings PWMEnrich.Dmelanogaster.background_2.0.0.tar.gz && mv PWMEnrich.Dmelanogaster.background.buildbin-libdir/* PWMEnrich.Dmelanogaster.background.Rcheck/ && rmdir PWMEnrich.Dmelanogaster.background.buildbin-libdir
StartedAt: 2013-03-24 12:43:46 -0700 (Sun, 24 Mar 2013)
EndedAt: 2013-03-24 12:47:39 -0700 (Sun, 24 Mar 2013)
EllapsedTime: 232.9 seconds
RetCode: 1
Status:  ERROR  
CheckDir: PWMEnrich.Dmelanogaster.background.Rcheck
Warnings: NA

Command output

* using log directory 'D:/biocbld/bbs-2.11-data-experiment/meat/PWMEnrich.Dmelanogaster.background.Rcheck'
* using R version 2.15.3 (2013-03-01)
* using platform: i386-w64-mingw32 (32-bit)
* using session charset: ISO8859-1
* using option '--no-vignettes'
* checking for file 'PWMEnrich.Dmelanogaster.background/DESCRIPTION' ... OK
* checking extension type ... Package
* this is package 'PWMEnrich.Dmelanogaster.background' version '2.0.0'
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking whether package 'PWMEnrich.Dmelanogaster.background' can be installed ... OK
* checking installed package size ... NOTE
  installed size is 57.0Mb
  sub-directories of 1Mb or more:
    data  57.0Mb
* checking package directory ... OK
* checking for portable file names ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* loading checks for arch 'i386'
** checking whether the package can be loaded ... OK
** checking whether the package can be loaded with stated dependencies ... OK
** checking whether the package can be unloaded cleanly ... OK
** checking whether the namespace can be loaded with stated dependencies ... OK
** checking whether the namespace can be unloaded cleanly ... OK
* loading checks for arch 'x64'
** checking whether the package can be loaded ... OK
** checking whether the package can be loaded with stated dependencies ... OK
** checking whether the package can be unloaded cleanly ... OK
** checking whether the namespace can be loaded with stated dependencies ... OK
** checking whether the namespace can be unloaded cleanly ... OK
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of 'data' directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... WARNING
  Warning: package needs dependence on R (>= 2.10)
* checking examples ...
** running examples for arch 'i386' ... ERROR
Running examples in 'PWMEnrich.Dmelanogaster.background-Ex.R' failed
The error most likely occurred in:

> assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: PWMEnrich.Dmelanogaster.background-package
> ### Title: PWMEnrich.Dmelanogaster.background package overview
> ### Aliases: PWMEnrich.Dmelanogaster.background-package
> ###   PWMEnrich.Dmelanogaster.background MotifDb.Dmel.PFM MotifDb.Dmel
> ###   PWMLogn.dm3.MotifDb.Dmel PWMCutoff4.dm3.MotifDb.Dmel
> ###   PWMCutoff5.dm3.MotifDb.Dmel PWMGEV.dm3.MotifDb.Dmel
> ###   PWMPvalueCutoff1e2.dm3.MotifDb.Dmel
> ###   PWMPvalueCutoff1e3.dm3.MotifDb.Dmel
> ###   PWMPvalueCutoff1e4.dm3.MotifDb.Dmel
> ### Keywords: package
> 
> ### ** Examples
> 
> 	data(PWMLogn.dm3.MotifDb.Dmel)
> 	
> 	res = motifEnrichment(DNAString("TGCATCAAGTGTGTAGTGCGATGAATGC"), PWMLogn.dm3.MotifDb.Dmel)
Scanning sequence 1 / 1
> 	
> 	head(motifRankingForGroup(res))
Error in head(motifRankingForGroup(res)) : 
  error in evaluating the argument 'x' in selecting a method for function 'head': Error: could not find function "motifRankingForGroup"
Execution halted
** running examples for arch 'x64' ... ERROR
Running examples in 'PWMEnrich.Dmelanogaster.background-Ex.R' failed
The error most likely occurred in:

> assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: PWMEnrich.Dmelanogaster.background-package
> ### Title: PWMEnrich.Dmelanogaster.background package overview
> ### Aliases: PWMEnrich.Dmelanogaster.background-package
> ###   PWMEnrich.Dmelanogaster.background MotifDb.Dmel.PFM MotifDb.Dmel
> ###   PWMLogn.dm3.MotifDb.Dmel PWMCutoff4.dm3.MotifDb.Dmel
> ###   PWMCutoff5.dm3.MotifDb.Dmel PWMGEV.dm3.MotifDb.Dmel
> ###   PWMPvalueCutoff1e2.dm3.MotifDb.Dmel
> ###   PWMPvalueCutoff1e3.dm3.MotifDb.Dmel
> ###   PWMPvalueCutoff1e4.dm3.MotifDb.Dmel
> ### Keywords: package
> 
> ### ** Examples
> 
> 	data(PWMLogn.dm3.MotifDb.Dmel)
> 	
> 	res = motifEnrichment(DNAString("TGCATCAAGTGTGTAGTGCGATGAATGC"), PWMLogn.dm3.MotifDb.Dmel)
Scanning sequence 1 / 1
> 	
> 	head(motifRankingForGroup(res))
Error in head(motifRankingForGroup(res)) : 
  error in evaluating the argument 'x' in selecting a method for function 'head': Error: could not find function "motifRankingForGroup"
Execution halted

PWMEnrich.Dmelanogaster.background.Rcheck/00install.out:


install for i386

* installing *source* package 'PWMEnrich.Dmelanogaster.background' ...
** data
** inst
** help
*** installing help indices
** building package indices
** testing if installed package can be loaded

install for x64

* installing *source* package 'PWMEnrich.Dmelanogaster.background' ...
** testing if installed package can be loaded
* MD5 sums
packaged installation of 'PWMEnrich.Dmelanogaster.background' as PWMEnrich.Dmelanogaster.background_2.0.0.zip

* DONE (PWMEnrich.Dmelanogaster.background)